The Incidence of Volatile Anesthesia Porcine Stress Syndrome in Pigs (Sus scrofa domesticus) Gives Implications for Physiology during Anesthesia

Introduction

Syndromes associated with stress have been shown to affect pigs. Malignant hyperthermia (MH) in pigs, also known as porcine stress syndrome (PSS), is a stress-induced medical condition in pigs characterized by a combination of clinical signs, including hyperthermia, tachycardia, tachypnea, and muscle rigidity that is rapidly fatal if left untreated.^7,8,13,15,19 MH/PSS occurs in response to stressful conditions such as environmental stressors (for example, transportation) and the use of volatile anesthetics such as halothane and isoflurane as stressors that trigger a physiologic stress response in the body.^7,8,13,15,19 MH/PSS is associated with an inherited, autosomal recessive mutation, HAL-1843, in the calcium-release channel protein ryanodine receptor 1 (RYR1), resulting in skeletal muscle sarcoplasmic reticulum hypersensitivity to calcium release.^7,8,13,15,16 This mutation has been found in practically all pig breeds, but Landrace, Yorkshire, Duroc, Pietrain, and Poland China were particularly susceptible to this mutation.^5,8 A genetic basis for MH/PSS was discovered in 1953, and a genetic test was developed in 1991 after discovery of the HAL-1843 (Arg615Cys) mutation, which has led to the condition largely being bred out of existence in production and research pigs.^7,8,13 While this mutation in RYR1 has been effectively eliminated in production animals by genetic testing, other reports show that a significant proportion of RYR1 HAL-1843 normal pigs (up to 30% or greater) are still sensitive to halothane anesthesia.^1–3 The halothane sensitivity responses include limb rigidity, blotching of skin, and tremors.

Another condition that clinically resembles MH/PSS (MH/PSS-like) has been described in the textbook “Swine in the Laboratory” as pigs having intraoperative or postoperative hyperthermia that can lead to death if untreated with cooling interventions.¹⁹ Although the pathogenesis of this is not fully understood, it is associated with increased lactate levels (greater than 2.5 mmol/L; normal = less than 2.2 mmol/L) and decreased pH during operative anesthesia.¹⁹ The incidence of MH/PSS-like syndrome is sporadic, and it can occur suddenly in a group of animals from a long-term supplier that has no history of similar conditions. Anecdotal information suggests a genetic predisposition since this condition tends to occur in groups of animals that may be closely related.¹⁹ Some research laboratories have been able to prevent the occurrence of MH/PSS-like syndrome by making anesthetic induction as nonstressful as possible by administering a preanesthetic intramuscular tranquilizer such as acepromazine 10 min before administration of potentially stressful anesthetics such as ketamine or tiletamine-zolazepam.¹⁹ The mutation for MH/PSS-like syndrome is not the HAL-1843 mutation of RYR1; therefore, animals will test negative for MH/PSS.

In 2012, another stress-induced condition that could be induced by transport, handling, or isoflurane anesthesia was identified.¹⁶ The clinical signs differed from those of MH/PSS in that they included open-mouth breathing, skin discoloration, vocalization, loss of mobility, and death. The affected population of pigs in the 2012 study also differed from the MH/PSS population in that the affected population was younger piglets (8 to 12 wk of age). This condition is caused by a defect in the dystrophin gene, which covers more than 2.4 million basepairs of DNA.^14,18 An arginine-to-tryptophan polymorphism in exon 41 of the pig dystrophin gene was the most significant DNA variant associated with stress susceptibility in that population. In humans, dystrophin mutations can cause physical deficits resulting in wheelchair confinement and early death due to cardiac and/or respiratory failure.¹⁰ Diseases associated with dystrophin mutations include the more severe Duchenne muscular dystrophy (DMD) and a milder Becker muscular dystrophy (BMD).^10,18 We developed a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) test for this variant in the dystrophin gene. The dystrophin gene is located on the X chromosome; females who test positive for the heterozygous genotype are carriers, and males who test positive are hemizygously affected. In the current study, we used this test after seeing some MH/PSS-like symptoms while pigs were under anesthesia, with the hypothesis that we would see a higher than expected incidence of animals positive for this dystrophin variant.

Materials and Methods

Dystrophin and RYR1 genotyping.

Forty-six whole-blood samples and 7 preserved formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissues were tested. DNA was successfully extracted from these samples for dystrophin variant testing. In addition, all the pigs were tested for the HAL-1843 mutation of RYR1 in conjunction with dystrophin variant testing (Table 2). Genomic DNA was extracted from blood or tissue using the DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD). Formalin-fixed paraffin-embedded tissues were first washed in xylene and ethanol before extraction. A nonsynonymous variant in dystrophin (DMD) that causes an amino acid change from arginine to tryptophan at amino acid 1953 in exon 41 (p.Arg1953Trp, rs196952080, NM_001012408)¹⁶ was genotyped using a PCR-RFLP assay. A 310-bp amplicon was produced using 0.8 µM forward (DMD-i40F; 5′-AAATGGCAACAGCCTATGAAA-3′) and reverse (DMD-i41R2; 5′-GGTTTGCCAGTACAAACTCACA-3′) primers, 0.2 µM dNTPs, 25–50 ng DNA, and 0.5 U Qiagen HotStar Taq DNA polymerase in 15-µL reactions. The cycling profile included the initial denaturing step at 94 °C for 15 min, followed by 94 °C for 30 s, 57 °C for 30 s, and 72 °C for 1 min for 35 cycles. The PCR product was then digested with 5 U AciI restriction enzyme (New England Biolabs, Ipswich, MA) at 37 °C for 2 h producing 75- and 235-bp fragments. Results from an example gel is shown in Figure 1. The normal C-allele in the restriction site (GCGG) is cut, while the affected T-allele (GTGG) is uncut. PCR products and AciI digests were run on 1.5% agarose gels in 1× TBE and visualized with ethidium bromide. DNA samples that were known to carry the 3 alternate genotypes were assayed along with unknown samples.

Table 2.Summary of biosample demographics for dystrophin variant testing

Clinical presentation of dystrophin variant
Sex	Positive	Negative	Total
Female	2 (28.6%)	5 (71.4%)	100%
Total	2	5	7
No clinical presentation of dystrophin variant
Sex	Positive	Negative	Total
Female	22 (47.8%)	24 (52.2%)	100%
Male	2 (20.0%)	8 (80.0%)	100%
Total	24	32	56

View Fullscreen

View Figure

• Download as Powerpoint
• Download Figure

The ryanodine receptor 1 (RYR1) 1843 mutation (p.Arg615Cys, rs344435545) was also genotyped using a PCR-RFLP assay.⁹ A 307-bp amplicon was produced using forward (RYR1-i17F; TTCTCAGTCACATCCCCACC) and reverse (RYR1-i18R; GTGGTGGAGGGTTCTAAGCT) primers and amplified under the same conditions as above. The PCR products were subsequently digested with 5 U HhaI restriction enzyme (New England Biolabs) at 37 °C for 2 h producing 132- and 175-bp fragments. The normal C-allele in the restriction site (GCGC) is cut, while the affected T-allele (GTGC) is uncut.

Results

Initial cases.

During the initial testing of research group A’s project, 2 pigs showed clinical signs of hyperthermia, skeletal muscle rigidity (Figure 2), tachycardia (Figure 3B), and irregular ECG (Figure 3) 8 h into isoflurane anesthesia. Subsequently, 5 additional pigs from the same supplier exhibited similar clinical signs, and research group B was also affected. Out of 11 pigs (Table 1), 8 had required euthanasia before the experimental endpoint due to elevated temperatures exceeding well beyond 39.5 °C (103.1 °F) with no signs of improvement; no attempts were made to cool these pigs. In addition, as the temperature increased, the animals’ heart rates became irregular, leading to arrhythmias. Two pigs had required euthanasia postprocedure due to failure to recover from anesthesia, and one pig fully recovered from the initial anesthetic event but later showed similar clinical signs when exposed to anesthesia in the future.

View Figure

• Download as Powerpoint
• Download Figure

View Figure

• Download as Powerpoint
• Download Figure

Changes in anesthetic protocols.

Additional data collected from the initial 7 pigs in research group A indicated that when subjected to isoflurane anesthesia, all subjects exhibited progressive increases in body temperature, as well as progressive tachycardia (Figure 4A). Subsequently, given the beneficial effects of dantrolene on malignant hyperthermia, research group A modified their protocol to include roughly 0.5–1 mg/kg dantrolene sodium administered intravenously in 2 subsequent subjects (Figure 4B). After 8 h into the protocol, the temperature of these 2 pigs increased from a baseline temperature of 37.95 °C (100.31 °F) to 39.5 °C (103.1 °F), at which point intravenous dantrolene was given. As seen in Figure 4B, one subject did not respond to dantrolene administration (circles), while the other subject (squares) may have transiently responded with stabilized heart rate and temperature for about 8 h, at which point tachycardia and hyperthermia resumed. The second modification involved adjusting the anesthesia protocol to reduce the amount of exposure to isoflurane by using a total intravenous anesthesia (TIVA) regimen consisting of propofol (2.0 to 4.4 mg/kg/h), fentanyl (0.003 to 0.005 mg/kg/h), and midazolam (0.4 to 0.7 mg/kg/h) after 1 to 2 h of isoflurane exposure. Switching to the TIVA regimen resulted in successful anesthesia without any of the previously mentioned clinical signs. The following 5 subjects that had TIVA for 24 h are shown in Figure 4C, which shows that these pigs did not display the hyperthermia and tachycardia seen while isoflurane anesthesia was used (Figure 4C).

View Figure

• Download as Powerpoint
• Download Figure

Dystrophin and RYR1 genotyping.

In total, blood samples from 63 pigs from this producer were genotyped for the dystrophin arginine to tryptophan variant and the HAL-1843 mutation of the RYR1 gene. Blood samples from 56 subsequent pig deliveries were tested, and FFPE tissue samples from 7 of the 11 original pigs that showed clinical signs were tested. One biosample was tested per animal. The sex distribution of the individuals that did not exhibit clinical signs was 46 females and 10 males, and the individuals that did exhibit clinical signs were divided into 7 females (Table 2).

As shown in Table 2 for pigs without clinical signs, there were 24 female dystrophin variant carriers (arginine and tryptophan alleles) and 2 males that were hemizygously affected with the tryptophan allele. Further, there were 24 out of 56 blood samples from pigs that did not show clinical signs that tested positive for a 42.9% dystrophin variant positivity rate; 22 out of 46 females (47.8%) that did not exhibit clinical signs were carriers, and 2 out of 10 affected males (20%) that did not exhibit clinical signs were affected.

With the exception of the male pig that recovered, all pigs tested that showed clinical signs were female and from research group A. Tissue samples from 3 pigs that showed clinical signs were not available; therefore, these individuals were not tested for the HAL-1843 mutation of RYR1 or the dystrophin variant. Among the pigs showing clinical signs, 2 out of the 7 (28.6%) tested positive for the dystrophin tryptophan variant. There were no females that tested positive for the homozygous genotype of the dystrophin variant. Fifty-four out of the 55 subsequent blood samples tested negative for the HAL-1842 mutation of the RYR1 gene, and one sample was inconclusive.

As shown in Figure 5A, the baseline creatine kinase, an enzyme indicative of muscle damage, was slightly elevated in dystrophin variant-positive carriers (723.4 ± 146.3 U/L) compared with dystrophin variant-negative pigs (596.8 ± 89.0 U/L), which was not statistically significant. Two-way ANOVA revealed an overall effect of anesthesia on creatine kinase (P = 0.0027) but not the dystrophin variant. Similarly, there was an effect of anesthesia on body temperature (P = 0.0018), but the effect of the dystrophin variant was not significant (P = 0.31). However, the change in temperature from baseline to time of death in the original 7 clinically affected pigs was higher in carriers (7.9 ± 0.8 °C) compared with noncarriers (5.2 ± 0.6 °C, P = 0.046). Moreover, 2-way ANOVA revealed an overall effect of anesthesia (P < 0.0001) and the dystrophin variant (P = 0.013) on heart rate (Figure 5C). Specifically, post hoc testing revealed that carriers had significantly elevated heart rates at the time of death compared with noncarriers (P = 0.044). Finally, there was an effect of anesthesia on lactate (Figure 5D) and pH (Figure 5E), but there was no effect of the dystrophin variant on either of these parameters.

View Figure

• Download as Powerpoint
• Download Figure

Discussion

Pigs showing physiologic signs of stress while undergoing inhalant anesthesia despite testing negative for MH have been reported since the 1990s.¹⁷ Unfortunately, these episodes are frequently unreported. Given similar experiences from collaborators using pigs (unpublished communications), our team was determined to report our experience and attempt to discover the cause of 11 sequential cases of adult pigs exhibiting clinical signs consistent with MH/PSS intraoperatively and postoperatively over a 3-mo period at our institution. Our differential diagnoses included MH/PSS as well as an unnamed porcine stress syndrome referred to as MH/PSS-like. We pursued genetic testing for RYR1 and dystrophin variants in subjects with available samples, and we prospectively determined the incidence of these variants in continued shipments from the supplier over a 4-mo time period; however, this was not a prospective study targeted to test the effects of the dystrophin variant on the induction of inhalational anesthesia related porcine stress syndrome. We examined the association between these variants and differences in clinical signs at baseline to determine the possibility of screening animals at risk for anesthesia-related stress events. The salient finding is that there is a higher-than-expected incidence of this dystrophin variant, which may confer clinical signs in response to volatile anesthetics. The dystrophin variant was not present in all tested samples of pigs that exhibited clinical signs, and not all of the animals with the dystrophin variant exhibited clinical signs, so the dystrophin variant, alone, cannot explain the clinical signs associated with this stress syndrome in the pigs. However, the higher-than-expected prevalence of the dystrophin variant does indicate that dystrophin could be one of the multiple genetic etiologies that form this unnamed, underreported stress syndrome that some research pigs exhibit while undergoing inhalant anesthesia. We propose to name this condition volatile anesthesia porcine stress syndrome (VAPSS), as an umbrella term that includes multiple genetic origins including MH/PSS.

The evidence supporting the differential diagnosis of MH/PSS included consistent clinical signs and breed disposition. The initial pigs exhibited the classic MH/PSS clinical signs of tachycardia, tachypnea, muscle rigidity, and hyperthermia before euthanasia during or after clinical exposure to isoflurane anesthesia. In addition, these pigs were composed of 3 breeds all shown to be affected by MH/PSS: Yorkshire, Landrace, and Duroc.⁵ Despite clinical evidence pointing toward a diagnosis of MH/PSS, all of the DNA samples tested negative for the HAL-1843 mutation of RYR1, which ruled out this condition. This was not surprising since MH/PSS was bred out of all research and production stock over a decade ago.^7,8,13 Similarly, we suggest that the development of a test for VAPSS could prove valuable for research and production pig breeders, as this novel stress syndrome has the potential to be bred out of existence in production and research herds such as MH/PSS. This would require not only the dystrophin variant test described herein but also the identification of other genetic factors predisposing pigs to VAPSS.

Hereditary evidence pointed toward MH/PSS-like as the cause because 2 of the first 6 pigs were at least half-siblings and possibly full siblings since they were from the same litter. The remaining 4 out of 6 pigs could not be more than half-siblings because they did not have the same dam, but they could have the same sire because the paternal lineage was unknown. The producer told us that they would no longer send pigs from the same litter to us for research purposes, but with an unknown paternal lineage, we cannot be sure that subsequent animals were unrelated. Breeding sows were kept on the producer’s farm, but semen was purchased from a commercial provider that incorporated multiple boars in each pool.

Many of the pigs analyzed carried a genotype from a previous report of a defect in dystrophin causing a novel stress syndrome.¹⁶ Because a complete genetic evaluation was not completed, we cannot say with 100% confidence that our pigs did not have additional dystrophin defects, but the most significant variant identified in that study was present in nearly half of our animals. A recent report also identified this same variant in porcine dystrophinopathies found during meat inspections.¹² However, this is an unexpected finding considering that the expected prevalence of the dystrophin variant is only approximately 5% in Landrace pigs (our pigs were Landrace crosses), and we observed an almost 48% incidence of carriers in female pigs that did not exhibit clinical signs. Even more abnormal is the sex distribution in affected animals, while we anticipated detecting a higher prevalence in males given that this is a sex-linked mutation, we found the variant in only 20% of males. Regardless, our hypothesis that dystrophin variants were present in our cohorts of animals was confirmed.

We believe that the unnamed, intraoperative, and postoperative stress syndrome that has been referred to as MH/PSS-like syndrome is what we are suggesting to call VAPSS. At the beginning of our investigation, we had hoped to link the cause of our 11 clinical pigs to the dystrophin variant. While we did find a higher-than-expected prevalence of the dystrophin variant in both pigs showing clinical signs and pigs that did not show clinical signs, we cannot determine that the dystrophin variant alone was responsible for the physiologic signs of stress in these RYR1 mutation-negative pigs. Five out of the 7 (71.4%) pigs that were tested after exhibiting clinical signs tested negative for the dystrophin variant, meaning there is another reason they showed clinical signs consistent with a stress syndrome. Furthermore, almost half of all subsequently tested female pigs tested positive for the dystrophin variant but did not exhibit clinical signs. This means that just having the dystrophin variant does not guarantee clinical signs when exposed to volatile inhalant anesthesia. The reasons behind the presence or absence of clinical signs are complex and may be affected by, for example, duration of exposure to anesthesia or subject age.

One possible genetic explanation for this is that there could be other allelic variants in dystrophin or there could be modifier genes that affect the expression of a possible dystrophinopathy. This has recently been extensively reported for human muscular dystrophy, and several modifier genes have been identified.^4,9 Furthermore, to provide more support for an effect of the dystrophin variant on disease progression, dystrophin protein would need to be quantified by Western blot and evaluated with clinical outcomes. In the original study outlining the discovery of the dystrophin defect, a genome-wide association analysis to identify the cause of the stress syndrome was done in a closed pig population along with an isoflurane challenge and phenotypic measures including creatine phosphokinase, EKG, and outcome of the challenge.¹⁶ Informed matings and testing were also used to further characterize the defect. Modifier genes or other disease loci were not identified in that study because any allelic variants affecting the disease severity were likely fixed or at low frequency or because of the small number (63) of affected animals tested. In addition, we were not aware of the availability of the dystrophin variant test at the time the pigs that exhibited clinical signs were euthanized, so analysis was limited to preserved tissue samples that were already collected for other purposes. The primary objective of this study is to report adverse events, rather than conduct a genomic analysis. Further studies are needed to explore the link between adult pigs exhibiting stress syndrome signs and disease variants.

Little is known about treatment for VAPSS due to its recent discovery and, the previously believed low prevalence of the dystrophin variant.¹² Before 2023, only 2 mutations of the dystrophin gene had been reported, and only one of these mutations was linked to a porcine stress syndrome.^12,16 Medical treatment for MH/PSS involves the immediate discontinuation of gas anesthesia, the administration of sodium bicarbonate to combat metabolic acidosis and hyperkalemia, and active cooling mechanisms, including ice packing, the administration of cooled intravenous fluids, fans, and air conditioning.⁷ The intravenous administration of dantrolene, a drug that slows the sarcoplasmic release of calcium while simultaneously permitting the continuation of calcium uptake, has also be used for treatment.⁷ Ryanodex (dantrolene sodium) was used by research group A for the treatment of 2 pigs that exhibited clinical signs consistent with those of MH/PSS 8 h after surgery, but this treatment showed mixed results. Possible explanations for this lack of effectiveness could be the timing of administration or the absence of a RYR1 mutation. The use of dantrolene after the patient has developed clinical signs is contrary to the manufacturer’s recommendation for administering the drug 75 min before surgery.⁶ Another explanation pertains to the dosage administered to each patient; ideally, each pig should have received a total of more than 200 mg but actually received approximately half of that dose. Regrettably, during the study, the substantial quantity required per patient posed a cost obstacle because this solution costs more than $1,300 per vial. Oral premedication with dantrolene is possible and is less expensive than intravenous dantrolene, but investigators associated with research group A were not aware of this route of administration at the time of their procedure. In addition, while dantrolene may be effective against MH/PSS, its efficacy may not be as pronounced in the context of VAPSS. Because our study was not designed to examine the timing or dosing of dantrolene, further studies are warranted to explore the potential effectiveness of dantrolene for patients with VAPSS, including other nondystrophin-related etiologies.

After research group A’s modifications were implemented, isoflurane exposure was limited to less than 2 h during the transition to the TIVA protocol outlined above, and 21 pigs were successfully maintained on TIVA without any apparent MH/PSS-like clinical signs. Although the patient’s condition did not return after the anesthesia was modified, we are not certain that the use of TIVA was curative. This is because isoflurane was still used during the initial induction, and this small amount of exposure could have been sufficient to result in a stress response if MH/PSS was the true cause. We do not know whether this amount of isoflurane exposure is enough to trigger a stress response in subjects with VAPSS, so further studies are needed to explore this possibility. It is possible that the abnormal clinical signs in these subsequent pigs disappeared independently of the switch to TIVA, which would match the textbook description of MH/PSS-like syndrome.¹⁹ Other potential recommendations for MH/PSS-like syndrome include moving away from premedication combinations of tiletamine-zolazepam and xylazine, changing injection sites, and selecting other breeds; it is not clear whether these strategies are helpful in VAPSS.

As shown in (Figure 5A), the dystrophin variant was associated with an increase in the enzyme creatine kinase, which is an indicator of muscle damage. This finding is consistent with our expectations because a previous study had shown increased creatine phosphokinase levels in dystrophin variant-affected pigs, although the magnitude of our results was less than that previously reported.¹⁶ In addition, while the baseline and time of death heart rate and temperature (Figure 5B and C) illustrated dystrophin variant-positive carriers had elevated temperature and pulse, this clinically relevant finding was not powered sufficiently to find a significant difference. Given similar differences in creatine kinase, baseline creatine values such as these could still prove valuable for screening pigs before use in research protocols involving isoflurane anesthesia.

Limitations in our study include the aforementioned underpowered nature of the study and the sex imbalance among females. Only 10 pigs exhibited abnormal clinical signs that required euthanasia before the protocol endpoints, and of these 10 pigs, samples were available for only 7 pigs. The majority of the pigs without clinical signs tested (46 out of 56) were female due to research group A’s protocol, which required a larger number of female pigs to be selected for the study because placing a urinary catheter during long anesthetic episodes is easier in females than in males. Moreover, creatine kinase and temperature data were not available for the males included in this study. Testing a greater number of males for the dystrophin variant may have yielded more positives, which would be consistent with expected results for sex-linked mutations.

The lone surviving pig from the original group of 11 clinical pigs was excluded from the analysis of pigs with clinical signs due to its outlier status in terms of sex, protocol, and clinical signs. Furthermore, there was no available hematology or hemodynamic data for analysis. Notably, this particular animal exhibited only hyperthermia without any additional clinical signs. Hyperthermia was observed solely on the day following the primary surgery when the pig was anesthetized for surgical repair of a prolapsed rectum. These findings contrast with those of the previous 10 pigs, all of which exhibited additional clinical signs, such as hypercapnia, skeletal muscle rigidity, and irregular cardiovascular responses. We suspect that the unexpected number of pigs exhibiting clinical signs consistent with MH/PSS led to the erroneous categorization of this pig compared with the previously euthanized 10 pigs.

Despite these limitations, we report a high incidence of a dystrophin variant that is associated with detrimental physiologic consequences during isoflurane administration. While the dystrophin variant cannot fully explain why we saw clinical signs consistent with a stress syndrome in these pigs, because some of them that exhibited clinical signs tested negative for the dystrophin variant, the unexpected number of positives indicate that the dystrophin variant may play a role in the manifestation of clinical signs in some pigs. Naming this condition VAPSS will provide a general terminology to refer to volatile anesthetic triggered stress syndromes, of which there seem to be multiple genetic etiologies, inclusive of, but not limited to the known HAL-1843 mutation of RYR1. Future labeling of these genetic specificities may allow for robust differentiation, testing, and eradication breeding strategies in the future.

In addition, our experiences also indicate that careful communication with biomedical pig suppliers is important and suggest a role for dystrophin variant testing in eliminating this anecdotal condition experienced in pig research. We urge researchers using pigs to report episodes of stress syndromes and to identify the other factors that cause VAPSS. We believe that dystrophin variants could contribute to VAPSS, but it is probably not the only possible defect. There is a test for this particular dystrophin variant, but other factors that contribute to VAPSS need to be identified and tests for them developed, so future pig researchers can screen pig shipments and adjust anesthesia accordingly. Animal welfare issues are of primary importance as pigs that undergo survival procedures with VAPSS suffer during the recovery period. There are larger implications for pig herd health outside of the research setting because pigs with the dystrophin mutation can die due to commonly encountered environmental factors such as transportation and hoof trimming, so it’s possible this could be extrapolated to all pigs with VAPSS. Furthermore, our study also demonstrated the importance of carefully considering anesthesia choice when performing porcine studies with prolonged anesthesia.